miRge - Extended Help Page

miRge.pl | miRge-build.pl

miRge.pl

A condensed version of this help is also available by calling perl miRge.pl --help from the command line.

miRge usage:

perl miRge.pl [--help] [--version] [--adapter none|illumina|ion|your_sequence(s)] [--species human|mouse|rat|fruitfly|nematode|zebrafish|custom_name] [--CPU #] [--diff-isomirs] [--phred64] [--bowtie] [--cutadapt] [--SampleFiles sample1.fastq,sample2.fastq,...]

Examples:

perl miRge.pl --help

perl miRge.pl --adapter illumina --species human --SampleFiles seq_file.fastq (minimum parameters to run miRge)

perl miRge.pl --adapter ion --species rat --CPU 8 --phred64 --SampleFiles human1.fastq,human2.fastq,human3.fastq

perl miRge.pl --adapter TGATGATCCTA species mouse --diff-isomirs --phred64 --bowtie /usr/local/bin/bowtie --SampleFiles sample1.fastq.gz

OPTIONS

miRge.pl takes the following arguments:

Required Parameters:

--SampleFiles

Provide a comma-separated list with no intervening spaces of fastq of fastq.gz formatted files containing all of the reads for each individual sample. The program will check that all fastq/fastq.gz files are found before beginning miRge. All files should be from the same species. Files can be of any size. Again, no intervening spaces.

Example: --SampleFiles sample1.fastq,sample2.fastq,sample3.fastq

--species human|mouse|rat|fruitfly|nematode|zebrafish|custom_name

Specify which reference species should be used. Used to align with miRge provided references. Custom reference files to any species can be generated with miRge-build.pl and can also be referenced here by their designated species name. More information on miRge-build.pl is below.

--adapter none|illumina|ion|your_sequence

Run adapter removal and quality filtering via cutadapt.

none: No adapater will be removed but QC filtering will occur

illumina: TGGAATTCTCGGGTGCCAAGGAACTCCAG (TruSeq small RNA kit adapater)

ion: remove first 11 base pairs (as per miRQC protocol)

your_sequence: Provide your own adapter sequence, such as --adapter TGGAATTCTC

your_sequence: In a multiplex run, if different samples have different adapters, more than one adapter can be called by separating the adapters by a comma. Note each sample will be compared to all listed adapters. --adapter TGGAATTCTC,CGTCTATGGC

Optional Parameters:

--help

Displays the usage message.

--version

Displays the version of miRge being used.

--CPU #

Specify the number of processors to use for the trimming, QC, and alignment steps.

default: 1

--diff-isomirs

Will output two additional files, xxx.isomirs.csv and xxx.isomirs.samples.csv. The first file has the entropy of each isomir as compared with their canonical miRNAs. The second file contains the entropy of each miRNA across all isomirs and determines the % of miRNA reads that are canonical. This is done by dividing the sum of all non-edited, but length variable miRNA reads against the sum of these reads plus all isomiR (RNA-edited) reads. This can be used to flag miRNAs that are predominately non-canonical isomiRs and may represent sequencing errors. For example, if a miRNA is only 5% canonical, that would be worrisome and suggest a possible misidentification.

default: not generated

--phred64

To be used when the input fastq files are known to be in phred64 format. By default miRge attempts to infer the phred score from the first 1000 reads of each file. If this fails to detect a phred64 score, this parameter can be used to force phred64.

default: not used

--bowtie

The path to the system's bowtie binary. This will be used if bowtie is not mapped to your directory. miRge automatically checks for bowtie and indices at the start of a run and will flag a problem. To check if bowtie is mapped to your directory, type bowtie --help at the command line. If you get the bowtie help, you are good to go. Otherwise to find bowtie on your system, type 'locate bowtie' at the command line and use the path identified. This can be useful if you run different versions of bowtie on your system.

default: bowtie is automatically called.

--cutadapt

The path to cutadapt. This will be used if cutadapt is not mapped to your directory. You can type 'locate cutadapt' to identify the path on your machine.

default: cutadapt is automatically called.

miRge-build.pl

miRge-build.pl provides a way for a user to make a custom library of any species to use with miRge. miRge-build creates 4 bowtie libraries from 4 designated files. miRge-build requires bowtie as a dependency and bowtie-build can be called if it is not on your path.

Usage:

perl miRge-build.pl [--help] [--species species_name] [--mirna fasta file] [--hairpin fasta file] [--other fasta file] [--mrna fasta file]

Examples:

perl miRge-build.pl --species aardvark --mirna aardvark_mirna.fa --hairpin aardvark_hairpin.fa --other aardvark_orna.fa --mrna aardvark_refseq.fa

OPTIONS

miRge-build takes the following arguments:

Required Parameters:

--species species_name

The name you give for the species here will be the name you use in miRge.pl when you call the species every time you use these libraries. The species_name given here corresponds to the directory under which these files are stored. As such, we recommend that if you are using libraries you intend to update, appending a version number or an identifier to keep these unique -- such as 'human_v4'.

--mirna

A fasta file consisting of mature miRNA reference sequences to align against. This can be obtained from mirbase.org. You can edit this to the extent we did, or not. For alignment purposes, you may need to extend the shorter miRNAs with additional genomic nucleotides (or a polyG run as described in Hackenberg M et al. Nucleic Acids Res. 2009:W68-76) to 25 bp.

--hairpin

A fasta file consisting of hairpin miRNA reference sequences to align against. The hairpin miRNAs can be obtained from mirBase.org. No editing of this file is necessary.

--other

A fasta file consisting of the additional reference sequences to align against. This file is used to identify additional sources of small noncoding RNA reads such as tRNAs, snoRNAs or rRNAs. This file can be found for most species at Ensembl (www.ensembl.org).

--mrna

A fasta file consisting of mRNAs or cDNAs. This file can be found for most species at Ensembl (www.ensembl.org).

Optional Parameters:

--bowtie-build

The path to your bowtie-build binary.

merges.csv file

A merges.csv file is an optional file that can be created to merge similar miRNAs. The first column contains the final name to be shown in the xxx.miR.Counts.csv and xxx.miR.RPM.csv files. The second, third, fourth, etc. columns contain the names of the miRNAs as present in the mirna.fa file that you wish to merge together. After miRge-build.pl creates the directory, place this file within the directory itself. The file should be names 'merges.csv' so that it will be recognized. An example of such a file is given here

default: No merges.csv file is used

Useful Information

A few notes on making a useful library. A good searchable library likely requires some trial and error. We have found to maximize alignment to the mature miRNAs, they should be extended into their hairpins on both the 5' and 3' sides as we described in our manuscript. We have found that some reported ESTs contain miRNAs. Once you build and test a library, it is a good idea to determine what reads mapped to your ESTs with high abundance and either view them on a tool like the UCSC Genome Browser or blast the sequence at NCBI. See if a miRNA or other small RNA species (snoRNA) are present in that space. If you identify a miRNA, you should purge either the entire EST or that region and rebuild the library. Otherwise, some isomiRs will incorrectly align to the mRNA file.

In certain circumstances, the sequence identity may be 100% over a stretch of 20 bases for two similar miRNAs. Thus any sequence that is 20 bp or less can align equally to two different miRNAs. In miRge, bowtie will randomly assign the sequence to one or the other. Since we perform a collapsing reads step, that single sequence may represent 1000s of individual reads and would skew to one named miRNA or the other. Many aligners have tackled this problem in a number of ways. We think there is no specific way to confirm to which miRNA that sequence belongs. Thus we have chosen to present this information as a shared miRNA such as hsa-let-7a-5p/7c-5p or hsa-miR-17-5p/106a-5p. This naming is achieved by using the merges.csv file. It can be a useful tool to avoid wide fluctuations in reads of two similar miRNAs between samples.